License: msRepDB is a unique resource that can be utilized either as downloadable and an online resource. An institutional license grants full access to both online and downloadable data for all faculty, researchers, staff and students of an academic or nonprofit institution. Please note that this license forbids the use of msRepDB to provide repeat masking or other genome data analysis services to external academic, nonprofit or for-profit customers of the licensed institution. For a license allowing this additional use, please contact us directly. It is recommended to use the chrome browser.
Home
About
Search and Download
1) Users can retrieve the complete repetitive sequences with annotation of the special species by selecting the species taxonomy name and repeat family name in the Search and Download interface.
2) Users can also download the comprehensive repetitive sequences with annotation of the specific species that they have retrieved to the local by clicking the "download" button on the interface.
Operation example:
1) Click the “species name” input box to trigger the list of candidate species names (Only part of the species is displayed in the drop-down box, you can find the interested species by typing in the input box, and the complete species name can be downloaded here );
2) Search and select "Drosophila melanogaster" in the list box of species taxonomy name, and click the “Search” button;
[Server response]: The server will display all the repetitive sequences and annotation information in the genome of Drosophila on the bottom of the interface.
3) Select "Drosophila melanogaster" in the list box of species taxonomy name, select “LTR/Pao” in the list box of repeat family name;
[Server response]: The server will display all the LTR-types of repetitive sequences and annotation in the genome of Drosophila on the bottom of the interface.
4) Click the "Download" button on the left of the interface;
[Server response]: The server will provide all the repetitive sequences with annotation of the species selected by the user in FASTA format, and the user can save the downloaded file to the preferred local directory through the "browse" option.
Species Selection Area
Online Masking
1) Users can submit the sequence file in FASTA format to be masked on the “Online Masking” interface by dragging and dropping or paste the sequence to be masked into the input box on the interface;
2) When the server completes the masking task, it will feed back the masking results to the interface, and the user can obtain detailed masking results and related reports by browsing and downloading.
Operation example:
1)Search and select "Drosophila melanogaster" in the list box of species taxonomy name (Only part of the species is displayed in the drop-down box, you can find the interested species by typing in the input box, and the complete species name can be downloaded here ).
2) Download the demo reference genome of Drosophila (Demo Reference Download) to the local disk. The complete Reference download address is (https://www.ncbi.nlm.nih.gov/assembly/GCF_000001215.4);
3) Upload the file "Drosophila_Ref_demo.fna” to the server by dragging and dropping from the online masking interface;
[Server response]: When the server received the submitted file, it will take several to ten minutes to complete masking and generate annotation reports. When the server completes the whole process of online masking, it will prompt that the task has been completed and provide download links for all generated reports.
4) Click the download links in the online masking interface, and save the masked sequence file and several annotation reports to the preferred local directory through the "browse" option.
Species Selection Area
OR
(Note: To view the results of online masking jobs, click the user name in the upper right corner of the page and select "Online Masking Jobs" in the drop-down box)
Submit
The submit function is mainly used to update the contents of the database. Update operations can be divided into the following two types.
1) Insert new records;
2) Update existing records in the database;
Operation example:
1) Enter the species' NCBI id, name, and repeat sequence with family information.
[Specific operation]:
Step1: Set the NCBI taxonomy id as “7227”;
Step2: Set the species scientific name as “Drosophila melanogaster”;
Step3: Set the NCBI accession id as “GCA_000001215.4”;
Step4: Set the repeat sequence with family information as
>Node_01#SINE/Alu
GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGTGGGAGGAT CGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAG TTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGG TGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGA TCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGAGCAACATAGCGAGACCCCGTCTCTT
AAAAAAAAAAAAAA
Step4: Click the "Submit" button;
2) Click the "Submit" button on the interface;
[Server response]: When the server received the submitted information, it will take several seconds to complete the storage and generate feedback information on the interface.
OR
Tools
The following tools are relevant to our research. If users want to expand the research or verify some results, they can download the tool by clicking the link after the tool name.
Team
Xingyu Liao [First Author], [Project designer]
Computational Bioscience Research Center (CBRC), Computer, Electrical and Mathematical Sciences and Engineering Division, King Abdullah University of Science and Technology (KAUST), Thuwal, 23955, Saudi Arabia.
E-mail: xingyu.liao@kaust.edu.sa
Kang Hu [Second Author], [Core developer]
Hunan Provincial Key Lab on Bioinformatics, School of Computer Science and Engineering, Central South University, Changsha, 410083, P.R. China.
E-mail: kanghu@csu.edu.cn
Adil Salhi [Third Author], [Project operation and maintenance personnel]
Structural and Functional Bioinformatics Group, Postdoctoral Fellows, Knowledge Mining Lab, King Abdullah University of Science and Technology (KAUST), Thuwal, 23955, Saudi Arabia. E-mail: adil.salhi@kaust.edu.sa
E-mail: adil.salhi@kaust.edu.sa
You Zou [Fourth Author], [Project operation and maintenance personnel]
Ph.D. Student, Research Engineer
High Performance Computing Center, Central South University, Changsha 410083, P.R. China.
E-mail: zouyou@csu.edu.cn
Jianxin Wang [Corresponding Author], [Project manager]
Hunan Provincial Key Lab on Bioinformatics, School of Computer Science and Engineering, Central South University, Changsha 410083, P.R. China.
E-mail: jxwang@mail.csu.edu.cn
Xin Gao [Corresponding Author], [Project manager]
Principal Investigator, Structural and Functional Bioinformatics Group, Acting Associate Director, Computational Bioscience Research Center (CBRC), King Abdullah University of Science and Technology (KAUST), Thuwal, 23955, Saudi Arabia.
E-mail: xin.gao@kaust.edu.sa
